Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3839656
End position: 3839715
Length: 60

DNA sequence
>NC_022785, from 3839656 to 3839715 (60 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGTGGTCTTCTTGGCGACCGTCTTCTTGGCCGCGGCCTTCTTCGCGGCGGCCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3838547-3840118	Sequence	M271_14880 - RNA polymerase sigma factor (Protein is coded in complementary strand; from 3840118 to 3838547)