Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3770057
End position: 3770092
Length: 36

DNA sequence
>NC_022785, from 3770057 to 3770092 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGTCGTGGCCGTCGTGGCCGTCGTGGCCGTCGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3770040-3771635	Sequence	M271_14580 - methyltransferase type 12 (Protein is coded in complementary strand; from 3771635 to 3770040)