Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3702721
End position: 3702744
Length: 24

DNA sequence
>NC_022785, from 3702721 to 3702744 (24 bp); Streptomyces rapamycinicus NRRL 5491 GATGTCGAGGTCGATGCCGATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3701936-3702925	Sequence	M271_14320 - uroporphyrinogen decarboxylase (Protein is coded in complementary strand; from 3702925 to 3701936)