Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3691952
End position: 3691978
Length: 27

DNA sequence
>NC_022785, from 3691952 to 3691978 (27 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCCGTACCGCCCGTACCGCCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3691265-3692800	Sequence	M271_14280 - protoporphyrinogen oxidase (Protein is coded in complementary strand; from 3692800 to 3691265)