Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3643246
End position: 3643281
Length: 36

DNA sequence
>NC_022785, from 3643246 to 3643281 (36 bp); Streptomyces rapamycinicus NRRL 5491 TCGACGGCGACGGCGACGGCGACGGCGACGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3642568-3643344	Sequence	M271_14075 - GntR family transcriptional regulator