Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3629969
End position: 3629992
Length: 24

DNA sequence
>NC_022785, from 3629969 to 3629992 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGGCCTGGGGCTGGGACTGGGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3629118-3629969	Sequence	M271_14010 - sugar ABC transporter permease (Protein is coded in complementary strand; from 3629969 to 3629118)