Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3609471
End position: 3609512
Length: 42

DNA sequence
>NC_022785, from 3609471 to 3609512 (42 bp); Streptomyces rapamycinicus NRRL 5491 CCACTGAACGAAGAGCGCTGAACGAAGAGCGCTGAACGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3608525-3609478	Sequence	M271_13890 - sulfate ABC transporter permease