Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3597039
End position: 3597083
Length: 45

DNA sequence
>NC_022785, from 3597039 to 3597083 (45 bp); Streptomyces rapamycinicus NRRL 5491 GGGCGGTGTCCCCGTGGGCGGTGTCCCCGTGGGCGGTGTCCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3596854-3598206	Sequence	M271_13830 - membrane protein (Protein is coded in complementary strand; from 3598206 to 3596854)