Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3540105
End position: 3540149
Length: 45

DNA sequence
>NC_022785, from 3540105 to 3540149 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCGAGTCGGCGGACTGCGAGTCGGCAGACTGCGAGTCGGTGGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3539201-3540889	Sequence	M271_13690 - hypothetical protein (Protein is coded in complementary strand; from 3540889 to 3539201)