Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3503500
End position: 3503535
Length: 36

DNA sequence
>NC_022785, from 3503500 to 3503535 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGTCCCCGGCGGCGTCCCCGGCGGCGTCCTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3503019-3503678	Sequence	M271_13520 - hypothetical protein (Protein is coded in complementary strand; from 3503678 to 3503019)