Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3492046
End position: 3492081
Length: 36

DNA sequence
>NC_022785, from 3492046 to 3492081 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCGCACCGGCCAGCGCACCGGCCGCCGCACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3491965-3493803	Sequence	M271_13470 - G-D-S-L family lipolytic protein