Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3450548
End position: 3450592
Length: 45

DNA sequence
>NC_022785, from 3450548 to 3450592 (45 bp); Streptomyces rapamycinicus NRRL 5491 AGGGGTTTCGGGTCGGGGGTTTTCGGGTCAGGGGGTTTCGGTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3449480-3450550	Sequence	M271_13300 - ADP-ribosylation/Crystallin J1
ORF... 3450576-3451343	Sequence	M271_13305 - hypothetical protein (Protein is coded in complementary strand; from 3451343 to 3450576)