Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3322960
End position: 3323004
Length: 45

DNA sequence
>NC_022785, from 3322960 to 3323004 (45 bp); Streptomyces rapamycinicus NRRL 5491 GTCATCCGACAACTAGTCACCCCACCACTAGTCCGCCCACAACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3321081-3322976	Sequence	M271_12730 - neuraminidase
ORF... 3323003-3323461	Sequence	M271_12735 - glyoxalase (Protein is coded in complementary strand; from 3323461 to 3323003)