Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3297122
End position: 3297145
Length: 24

DNA sequence
>NC_022785, from 3297122 to 3297145 (24 bp); Streptomyces rapamycinicus NRRL 5491 TGACGGTGAGGGTGGCGGTGAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3296356-3298809	Sequence	M271_12630 - glycosyl hydrolase (Protein is coded in complementary strand; from 3298809 to 3296356)