Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3296219
End position: 3296254
Length: 36

DNA sequence
>NC_022785, from 3296219 to 3296254 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGGGTCCGGAGTCGCGTCCGGAGTCGGGTCTGGAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3294838-3296277	Sequence	M271_12625 - glycosyl hydrolase (Protein is coded in complementary strand; from 3296277 to 3294838)