Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 323921
End position: 323944
Length: 24

DNA sequence
>NC_022785, from 323921 to 323944 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCGGTGCCGTTGACGGTGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 322599-324455	Sequence	M271_01305 - cation-transporting ATPase (Protein is coded in complementary strand; from 324455 to 322599)