Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3228605
End position: 3228628
Length: 24

DNA sequence
>NC_022785, from 3228605 to 3228628 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCGACCGCGACGGCGGCCGCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3225941-3228811	Sequence	M271_12340 - hypothetical protein (Protein is coded in complementary strand; from 3228811 to 3225941)