Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3093902
End position: 3093955
Length: 54

DNA sequence
>NC_022785, from 3093902 to 3093955 (54 bp); Streptomyces rapamycinicus NRRL 5491 CCGGTGGCCTTGCCGGGGCCGGTGGCCTTGCTGGGGCCGGTGGCCTTGCCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3092429-3095536	Sequence	M271_11795 - dimethylmenaquinone methyltransferase (Protein is coded in complementary strand; from 3095536 to 3092429)