Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3056825
End position: 3056869
Length: 45

DNA sequence
>NC_022785, from 3056825 to 3056869 (45 bp); Streptomyces rapamycinicus NRRL 5491 TTCTCGCCACCAGGCTTCCCGCCACCGGCCGTCTCGCCACCGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3056654-3057547	Sequence	M271_11615 - hypothetical protein (Protein is coded in complementary strand; from 3057547 to 3056654)