Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3049378
End position: 3049401
Length: 24

DNA sequence
>NC_022785, from 3049378 to 3049401 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCGTCGCCGCCGCCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3049315-3050328	Sequence	M271_11575 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 3050328 to 3049315)