Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 3023477
End position: 3023506
Length: 30

DNA sequence
>NC_022785, from 3023477 to 3023506 (30 bp); Streptomyces rapamycinicus NRRL 5491 GTCTGGGTCTGGGTTTGGGCCTGGGCCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3022925-3023614	Sequence	M271_11480 - hypothetical protein (Protein is coded in complementary strand; from 3023614 to 3022925)