Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2989326
End position: 2989391
Length: 66

DNA sequence
>NC_022785, from 2989326 to 2989391 (66 bp); Streptomyces rapamycinicus NRRL 5491 GCGCCGTCAGGGCGTCAGGCCAGCGCTGTCAGGGCGTCAGGCCAGCGCCGTCGGGGCGTCAGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2989390-2990712	Sequence	M271_11335 - carboxypeptidase (Protein is coded in complementary strand; from 2990712 to 2989390)