Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2939199
End position: 2939252
Length: 54

DNA sequence
>NC_022785, from 2939199 to 2939252 (54 bp); Streptomyces rapamycinicus NRRL 5491 GGGGGTACGGGCCCCGGCGCGGGTACGGGCCCCGGTGGCGGTACGCGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2939179-2941146	Sequence	M271_11145 - 1-deoxy-D-xylulose-5-phosphate synthase (Protein is coded in complementary strand; from 2941146 to 2939179)