Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2928992
End position: 2929024
Length: 33

DNA sequence
>NC_022785, from 2928992 to 2929024 (33 bp); Streptomyces rapamycinicus NRRL 5491 CCGATCAGCTGCCGATCATCAGCCGGTCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2929019-2929906	Sequence	M271_11100 - chitinase (Protein is coded in complementary strand; from 2929906 to 2929019)