Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2922188
End position: 2922211
Length: 24

DNA sequence
>NC_022785, from 2922188 to 2922211 (24 bp); Streptomyces rapamycinicus NRRL 5491 GAGCGGGAGTGGGCGCGGGAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2922181-2922933	Sequence	M271_11065 - GntR family transcriptional regulator