Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2917432
End position: 2917479
Length: 48

DNA sequence
>NC_022785, from 2917432 to 2917479 (48 bp); Streptomyces rapamycinicus NRRL 5491 CGGCTGGGAGCGCGTCCGGACGGGAACGCGTCCAGATGGGAACGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2916236-2917432	Sequence	M271_11040 - alanine racemase
ORF... 2917480-2918445	Sequence	M271_11045 - membrane protein (Protein is coded in complementary strand; from 2918445 to 2917480)