Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2915678
End position: 2915731
Length: 54

DNA sequence
>NC_022785, from 2915678 to 2915731 (54 bp); Streptomyces rapamycinicus NRRL 5491 GGCCCACCGCCCGCGAAGAGCCCACCGCCCGCGAAGTGCCCACCGCCCGCGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2914910-2916028	Sequence	M271_11035 - hypothetical protein (Protein is coded in complementary strand; from 2916028 to 2914910)