Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2835206
End position: 2835238
Length: 33

DNA sequence
>NC_022785, from 2835206 to 2835238 (33 bp); Streptomyces rapamycinicus NRRL 5491 GCCGCGGGGCGGCCGAGGAGCGGCCGCGGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2835103-2835885	Sequence	M271_10630 - ABC transporter permease (Protein is coded in complementary strand; from 2835885 to 2835103)