Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2806128
End position: 2806151
Length: 24

DNA sequence
>NC_022785, from 2806128 to 2806151 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGGCGGCGCCGGTGGCGGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2803439-2806186	Sequence	M271_10475 - hypothetical protein (Protein is coded in complementary strand; from 2806186 to 2803439)