Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2785304
End position: 2785357
Length: 54

DNA sequence
>NC_022785, from 2785304 to 2785357 (54 bp); Streptomyces rapamycinicus NRRL 5491 GTGGTGCGGGCGGAGTTTGTGGTGCGGGCGGAGTTTGTGGTGCGGGCGGAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2785214-2785873	Sequence	M271_10385 - Holliday junction resolvase (Protein is coded in complementary strand; from 2785873 to 2785214)