Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2781885
End position: 2781908
Length: 24

DNA sequence
>NC_022785, from 2781885 to 2781908 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGAGGAGGATGCGGAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2780644-2782380	Sequence	M271_10365 - preprotein translocase subunit SecD (Protein is coded in complementary strand; from 2782380 to 2780644)