Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2695246
End position: 2695269
Length: 24

DNA sequence
>NC_022785, from 2695246 to 2695269 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGGCGGGGGTGGGCGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2694819-2695274	Sequence	M271_09990 - membrane protein (Protein is coded in complementary strand; from 2695274 to 2694819)