Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2677873
End position: 2677897
Length: 25

DNA sequence
>NC_022785, from 2677873 to 2677897 (25 bp); Streptomyces rapamycinicus NRRL 5491 GCCGTGGCGTCCCGTGCGGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2676109-2677983	Sequence	M271_09940 - hypothetical protein (Protein is coded in complementary strand; from 2677983 to 2676109)