Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2609337
End position: 2609360
Length: 24

DNA sequence
>NC_022785, from 2609337 to 2609360 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCAGACCCAGACCCGGATCCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2607721-2614701	Sequence	M271_09790 - hypothetical protein (Protein is coded in complementary strand; from 2614701 to 2607721)