Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2563865
End position: 2563918
Length: 54

DNA sequence
>NC_022785, from 2563865 to 2563918 (54 bp); Streptomyces rapamycinicus NRRL 5491 TCGGGGGTTTCCGTGGTGTCGGCGGTTTCCGTGGTGCCGGGGGTTTCCGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2557047-2568556	Sequence	M271_09765 - hypothetical protein (Protein is coded in complementary strand; from 2568556 to 2557047)