Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2527878
End position: 2527913
Length: 36

DNA sequence
>NC_022785, from 2527878 to 2527913 (36 bp); Streptomyces rapamycinicus NRRL 5491 CAGCACCAGCACCAGCACCAGCACCAGCACCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2520404-2529583	Sequence	M271_09720 - hypothetical protein (Protein is coded in complementary strand; from 2529583 to 2520404)