Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2498492
End position: 2498515
Length: 24

DNA sequence
>NC_022785, from 2498492 to 2498515 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCTCATCCTCACCCTCATCCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2496266-2499859	Sequence	M271_09695 - hypothetical protein (Protein is coded in complementary strand; from 2499859 to 2496266)