Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2491797
End position: 2491832
Length: 36

DNA sequence
>NC_022785, from 2491797 to 2491832 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCTCGTGGAGACCTTCGCGGAGACTTTCGTGGAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2491046-2491894	Sequence	M271_09670 - hypothetical protein (Protein is coded in complementary strand; from 2491894 to 2491046)