Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2445926
End position: 2445970
Length: 45

DNA sequence
>NC_022785, from 2445926 to 2445970 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGTCTTCCGTGACGAGGTCTTCCGTGACGACCTCTTCCGTGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2444866-2446164	Sequence	M271_09445 - hypothetical protein (Protein is coded in complementary strand; from 2446164 to 2444866)