Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2431437
End position: 2431481
Length: 45

DNA sequence
>NC_022785, from 2431437 to 2431481 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCCGGGGTGTGCGGTGAGGGAGTGTGCGGTGCCGAGGTGTGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2429854-2431851	Sequence	M271_09385 - hypothetical protein (Protein is coded in complementary strand; from 2431851 to 2429854)