Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2403082
End position: 2403117
Length: 36

DNA sequence
>NC_022785, from 2403082 to 2403117 (36 bp); Streptomyces rapamycinicus NRRL 5491 CACCGGCGACACCGGCGACACCGGCGACACCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2402940-2404613	Sequence	M271_09310 - D-ribose transporter ATP binding protein (Protein is coded in complementary strand; from 2404613 to 2402940)