Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2397565
End position: 2397592
Length: 28

DNA sequence
>NC_022785, from 2397565 to 2397592 (28 bp); Streptomyces rapamycinicus NRRL 5491 CCCGCGCCGCGCGCTCCGCGCCCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2396808-2397821	Sequence	M271_09280 - LacI family transcription regulator (Protein is coded in complementary strand; from 2397821 to 2396808)