Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2367449
End position: 2367502
Length: 54

DNA sequence
>NC_022785, from 2367449 to 2367502 (54 bp); Streptomyces rapamycinicus NRRL 5491 TCCTCGGCGAACCCGTCCTCCTCGGCGAACCCACCTCCCCGGGCGAACCCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2367110-2368267	Sequence	M271_09155 - hypothetical protein (Protein is coded in complementary strand; from 2368267 to 2367110)