Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2355470
End position: 2355519
Length: 50

DNA sequence
>NC_022785, from 2355470 to 2355519 (50 bp); Streptomyces rapamycinicus NRRL 5491 CCGTGCCCAGCCGTGCTCAGCCGTGTCCGGGCGTGCTCAGCCGTGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2355507-2357603	Sequence	M271_09100 - hypothetical protein (Protein is coded in complementary strand; from 2357603 to 2355507)