Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 233454
End position: 233489
Length: 36

DNA sequence
>NC_022785, from 233454 to 233489 (36 bp); Streptomyces rapamycinicus NRRL 5491 TCCCGGCTCGCCTCCCGGCCCGCTTCCTGGATCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 233019-234146	Sequence	M271_00900 - histidine kinase (Protein is coded in complementary strand; from 234146 to 233019)