Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2289665
End position: 2289688
Length: 24

DNA sequence
>NC_022785, from 2289665 to 2289688 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGCGGCCGGGGCCGAGGCCGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2288778-2289704	Sequence	M271_08960 - nitrate ABC transporter permease (Protein is coded in complementary strand; from 2289704 to 2288778)