Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2186606
End position: 2186641
Length: 36

DNA sequence
>NC_022785, from 2186606 to 2186641 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGTTCAACGGGACGTTCGGCGGGACTTTCAACGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2186634-2187779	Sequence	M271_08580 - acetyl-CoA acetyltransferase (Protein is coded in complementary strand; from 2187779 to 2186634)