Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2109994
End position: 2110017
Length: 24

DNA sequence
>NC_022785, from 2109994 to 2110017 (24 bp); Streptomyces rapamycinicus NRRL 5491 AGGCCGAGGACGACGCCGAGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2109118-2110662	Sequence	M271_08185 - MFS transporter (Protein is coded in complementary strand; from 2110662 to 2109118)