Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 2048246
End position: 2048269
Length: 24

DNA sequence
>NC_022785, from 2048246 to 2048269 (24 bp); Streptomyces rapamycinicus NRRL 5491 GGGGCCGAGGGGGCGACGGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2046909-2048273	Sequence	M271_07870 - membrane protein
ORF... 2048270-2049274	Sequence	M271_07875 - membrane protein