Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1991729
End position: 1991752
Length: 24

DNA sequence
>NC_022785, from 1991729 to 1991752 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCCGGAGCCGGTGCGGGAGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1991565-1992689	Sequence	M271_07575 - asparaginase (Protein is coded in complementary strand; from 1992689 to 1991565)